Order Kazusa clone(s) from : ![]() |
Product ID | ORK00580 |
---|---|
Accession No | AB014531 |
Description | acyl-CoA synthetase bubblegum family member 1, transcript variant 1 |
Clone name | hh01881s1 |
Vector information | |
cDNA sequence | DNA sequence (6162 bp) Predicted protein sequence (729 aa) |
HaloTag ORF Clone |
FHC00580
![]() |
Flexi ORF Clone | FXC00580 |
Source | Human adult brain |
Rouge ID |
mKIAA0631
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01881, former representative clones for KIAA0631 with hh01881s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3972 bp |
---|---|
Genome contig ID | gi51511731r_76147228 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99637 - 99588) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 76246865 | 76313913 | 14 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000873 | 279 | 290 | PR00154 | AMP-dependent synthetase and ligase |
IPR000873 | 291 | 299 | PR00154 | AMP-dependent synthetase and ligase | |
HMMPfam | IPR000873 | 139 | 604 | PF00501 | AMP-dependent synthetase and ligase |
ScanRegExp | IPR000873 | 284 | 295 | PS00455 | AMP-dependent synthetase and ligase |
![]() |
---|
Primer_f | AGATGTATCCGCAAACTAAAC |
---|---|
Primer_r | ATGAAAGAGCAGCCGAGTAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGATGTATCCGCAAACTAAAC |
Primer_r | ATGAAAGAGCAGCCGAGTAAC |
PCR product length | 89 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |