KIAA0631

Product ID	ORK00580
Accession No	AB014531
Description	acyl-CoA synthetase bubblegum family member 1, transcript variant 1
Clone name	hh01881s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6162 bp) Predicted protein sequence (729 aa)
HaloTag ORF Clone	FHC00580
Flexi ORF Clone	FXC00580
Source	Human adult brain
Rouge ID	mKIAA0631 by Kazusa Mouse cDNA Project
Note	We replaced hh01881, former representative clones for KIAA0631 with hh01881s1. (2002/5/10)

Length: 6162 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3972 bp
Genome contig ID	gi51511731r_76147228
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCACAATTTTTGTTAAAAAGGACCTCAAATTAGG
Flanking genome sequence (99637 - 99588)	----+--------+--------+--------+--------+----* GATGAGTCTTCAAGTGCATTATTTCCTCTAACTTCGGAATAGCCCGCGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	76246865	76313913	14	99.3	Perfect prediction

Length: 729 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96GR2	100.0	Long-chain-fatt...	Homo sapiens
AAG09404	99.9	very long-chain...	Homo sapiens
BAG37108	99.9	unnamed protein...	Homo sapiens
BAG51439	99.7	unnamed protein...	Homo sapiens
BAH12022	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020644	2.8e-29	26.0	KIAA0837

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000873	279	290	PR00154	AMP-dependent synthetase and ligase
FPrintScan	IPR000873	291	299	PR00154	AMP-dependent synthetase and ligase
HMMPfam	IPR000873	139	604	PF00501	AMP-dependent synthetase and ligase
ScanRegExp	IPR000873	284	295	PS00455	AMP-dependent synthetase and ligase

Primer_f	AGATGTATCCGCAAACTAAAC
Primer_r	ATGAAAGAGCAGCCGAGTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGATGTATCCGCAAACTAAAC
Primer_r	ATGAAAGAGCAGCCGAGTAAC
PCR product length	89 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles