ROUGE

Gene/Protein Characteristic Table for mKIAA0618

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172982
Description :	nuclear pore membrane protein 121.
Clone Name :	mfj10160 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4955 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3022 bp

Genome contig ID gi65498774r_134289638
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGCTTATGTCATTAAAAATAAAACTGTGATCTGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATAGATGTGAGTTTGCCCTTTATTTGTGAAGCGAAGAACTCGTGACTGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0618 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0618	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1915, 1932..2930
Length: 971 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8K3Z9	0	99.5	Nuclear envelop...	Mus musculus
AAM64199	0	99.4	nuclear pore me...	Mus musculus
P52591	5.6e-214	90.6	Nuclear envelop...	Rattus norvegicus
EDM13370	7.3e-214	90.6	nuclear pore me...	Rattus norvegicus
XP_001110084	6.8e-115	69.0	nuclear pore me...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122189	1.3e-06	27.7	mKIAA0023
AK038404	7.8e-06	25.7	mKIAA2032

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 151 225 PS50324 NULL

NULL 427 536 PS50324 NULL

NULL 531 628 PS50325 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	151	225	PS50324	NULL
NULL	427	536	PS50324	NULL
NULL	531	628	PS50325	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3022 bp
Genome contig ID	gi65498774r_134289638
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGCTTATGTCATTAAAAATAAAACTGTGATCTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAGATGTGAGTTTGCCCTTTATTTGTGAAGCGAAGAACTCGTGACTGGT

Gene/Protein Characteristic Table for mKIAA0618

Features of the cloned DNA sequence

Features of the protein sequence