| ROUGE |
Gene/Protein Characteristic Table for mKIAA0581 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129166 |
|---|---|
| 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 1. | |
| mbg02025 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5977 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3221 bp Genome contig ID gi66880554f_134676033 PolyA signal sequence
(AATAAA,-19)
ATTGTCCAAAGGAAACAATAAAAATTTCTTAACACFlanking genome sequence
(313079 - 313128)
AGTCCAGCTGGACCTTCTTAGAGTCACAGCCCACTTTACAGGGGTCAGTG
KIAA Alignment based on: KIAA0581 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..2657, 2770..3003
Length: 962 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001711 | 64 | 407 | PD001202 | Phosphatidylinositol-specific phospholipase C |
| FPrintScan | IPR001192 | 65 | 83 | PR00390 | Phosphoinositide-specific phospholipase C (PLC) |
| IPR001192 | 91 | 111 | PR00390 | Phosphoinositide-specific phospholipase C (PLC) | |
| IPR001192 | 195 | 212 | PR00390 | Phosphoinositide-specific phospholipase C (PLC) | |
| IPR001192 | 338 | 359 | PR00390 | Phosphoinositide-specific phospholipase C (PLC) | |
| IPR001192 | 359 | 377 | PR00390 | Phosphoinositide-specific phospholipase C (PLC) | |
| IPR001192 | 506 | 516 | PR00390 | Phosphoinositide-specific phospholipase C (PLC) | |
| HMMPfam | IPR000909 | 61 | 212 | PF00388 | Phosphatidylinositol-specific phospholipase C |
| IPR001711 | 283 | 400 | PF00387 | Phosphatidylinositol-specific phospholipase C | |
| IPR000008 | 422 | 505 | PF00168 | C2 | |
| HMMSmart | IPR000909 | 60 | 211 | SM00148 | Phosphatidylinositol-specific phospholipase C |
| IPR001711 | 284 | 400 | SM00149 | Phosphatidylinositol-specific phospholipase C | |
| IPR000008 | 421 | 520 | SM00239 | C2 | |
| ProfileScan | IPR000909 | 60 | 211 | PS50007 | Phosphatidylinositol-specific phospholipase C |
| IPR001711 | 284 | 400 | PS50008 | Phosphatidylinositol-specific phospholipase C | |
| IPR000008 | 407 | 505 | PS50004 | C2 | |
| NULL | 658 | 832 | PS50318 | NULL |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage 
| |
