| ROUGE |
Gene/Protein Characteristic Table for mKIAA0581 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129166 |
|---|---|
| 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 1. | |
| mbg02025 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5977 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3221 bp Genome contig ID gi66880554f_134676033 PolyA signal sequence
(AATAAA,-19)
ATTGTCCAAAGGAAACAATAAAAATTTCTTAACACFlanking genome sequence
(313079 - 313128)
AGTCCAGCTGGACCTTCTTAGAGTCACAGCCCACTTTACAGGGGTCAGTG
KIAA Alignment based on: KIAA0581 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..2657, 2770..3003
Length: 962 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage 
| |
