ROUGE

Gene/Protein Characteristic Table for mKIAA0552

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC058280
Description :	ProSAPiP1 protein.
Clone Name :	mbp12120 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1718 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 33 bp

Genome contig ID gi66880554r_130048587
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GATTCTCTACGTGCACAACCTTCTGACACGTGCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTCTGAAGGTCGGAGTCACCAATGTCCCTTCCATTCATCTCCCTTCCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0552 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0552	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1685
Length: 560 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM13272	2.4e-162	100.0	ProSAPiP1 prote...	Mus musculus
AAH58280	2.7e-161	100.0	Prosapip1 prote...	Mus musculus
EDL80204	3.7e-160	98.6	ProSAPiP1 prote...	Rattus norvegicus
CAM13273	7.4e-149	83.1	ProSAPiP1 prote...	Mus musculus
EDL80205	7.6e-147	81.7	ProSAPiP1 prote...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129446	2.9e-23	39.5	mKIAA1813
AK049249	2.4e-08	33.5	mKIAA0341

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009638 325 526 PF06818 Fez1

ProfileScan NULL 75 193 PS50315 NULL

NULL 107 181 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	325	526	PF06818	Fez1
ProfileScan	NULL	75	193	PS50315	NULL
NULL	107	181	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	33 bp
Genome contig ID	gi66880554r_130048587
PolyA signal sequence (None)	+--------+--------+----*----+---- GATTCTCTACGTGCACAACCTTCTGACACGTGCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTCTGAAGGTCGGAGTCACCAATGTCCCTTCCATTCATCTCCCTTCCCC

Gene/Protein Characteristic Table for mKIAA0552

Features of the cloned DNA sequence

Features of the protein sequence