ROUGE |
Gene/Protein Characteristic Table for mKIAA0534 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172967 |
---|---|
Weakly similar to DJ741H3.1.2 (Fragment). | |
mpf00179 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6567 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2124 bp Genome contig ID gi65553144f_57096774 PolyA signal sequence
(AATAAA,-33) +----*----+----*----+----*----+----
GAAATAAAATTCTTCACCCCCGGGTGAAGTGAACCFlanking genome sequence
(622298 - 622347) ----+----*----+----*----+----*----+----*----+----*
AAAAACCACCTCGTTCTCTGTGTCTTCCTCCTCCCACTGCACATCCTAAA
KIAA Alignment based on: KIAA0534 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 109..4443
Length: 1444 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |