ROUGE |
Gene/Protein Characteristic Table for mKIAA0460 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129150 |
---|---|
mpm03155 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4558 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 399 bp Genome contig ID gi65492966r_95151114 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ACTTACATCGAAATAAAACTTCGGTCAGTACAGGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATAACGTGCAATGTTGGGGTGTTATTTGGGTCTTGGCCTTGCTGATGGT
KIAA Alignment based on: KIAA0460 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..4159
Length: 1385 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |