ROUGE

Gene/Protein Characteristic Table for mKIAA0454

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122286
Description :
Clone Name :	mbg06114 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6185 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2417 bp

Genome contig ID gi65492966r_97125131
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TTTTTTTAATATTATAATAAAATAAACTTAGTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCATCAAGTTCTTATAGAAGTTTGTGCTCCCATAAGAAATTTCTTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0454 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0454	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 358..3768
Length: 1136 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH50783	100.0	Phosphodiestera...	Mus musculus
EDL38943	100.0	phosphodiestera...	Mus musculus
EDL85579	95.4	rCG51764, isofo...	Rattus norvegicus
AAI48979	85.8	PDE4DIP protein...	Bos taurus
CAH92060	86.5	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB026497	8.3e-05	21.4	mKIAA0216
AK129349	0.001	22.6	mKIAA1398

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2417 bp
Genome contig ID	gi65492966r_97125131
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TTTTTTTAATATTATAATAAAATAAACTTAGTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCATCAAGTTCTTATAGAAGTTTGTGCTCCCATAAGAAATTTCTTGA

Gene/Protein Characteristic Table for mKIAA0454

Features of the cloned DNA sequence

Features of the protein sequence