ROUGE

Gene/Protein Characteristic Table for mKIAA0452

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172951
Description :
Clone Name :	mid16058 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2257 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 531 bp

Genome contig ID gi65493515f_108274892
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTGGGTCCAAACAAAATAAAGCAAATTAAGTTGCT
Flanking genome sequence
(128752 - 128801)
----+----*----+----*----+----*----+----*----+----*
AACATTTAATATAGTTTTCATATACATTTTTGTCTTCTAATTGAAAAACA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0452 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0452	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1726
Length: 574 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH26660	100.0	Tetratricopepti...	Mus musculus
EDL30709	100.0	RIKEN cDNA 4922...	Mus musculus
AAH23883	99.8	Tetratricopepti...	Mus musculus
A2ACP1	100.0	Tetratricopepti...	Mus musculus
EDL30706	100.0	RIKEN cDNA 4922...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 507 540 PF07719 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	507	540	PF07719	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	531 bp
Genome contig ID	gi65493515f_108274892
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTGGGTCCAAACAAAATAAAGCAAATTAAGTTGCT
Flanking genome sequence (128752 - 128801)	----+--------+--------+--------+--------+----* AACATTTAATATAGTTTTCATATACATTTTTGTCTTCTAATTGAAAAACA

Gene/Protein Characteristic Table for mKIAA0452

Features of the cloned DNA sequence

Features of the protein sequence