KIAA0452

Product ID	ORK04348
Accession No	AB007921
Description	tetratricopeptide repeat domain 39A
Clone name	hg00323
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6256 bp) Predicted protein sequence (453 aa)
Source	Human adult brain
Rouge ID	mKIAA0452 by Kazusa Mouse cDNA Project

Length: 6256 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4893 bp
Genome contig ID	gi89161185r_51435779
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTTAGCCTGGGCGACAGAGCGAGACCACATC
Flanking genome sequence (99712 - 99663)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGATGGGACCGGGAACAGATTTCAGGGAGGGAGACTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	51535491	51569587	11	99.2	Perfect prediction

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06825	1.1e-153	98.2	hCG40295, isofo...	Homo sapiens
CAI13138	1.1e-153	98.2	tetratricopepti...	Homo sapiens
CAI13136	9.2e-130	97.0	tetratricopepti...	Homo sapiens
Q5SRH9	1.2e-129	99.1	Tetratricopepti...	Homo sapiens
AAH28374	2.2e-129	93.1	TTC39A protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACAGTGGACATTTGGGGAGCG
Primer_r	GAATCCATCCCTCCTGAATCC
PCR product length	121 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles