ROUGE

Gene/Protein Characteristic Table for mKIAA4111

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220290
Description :	Insulin-like growth factor binding protein complex acid labile chain precursor.
Clone Name :	mid39041 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 262 bp

Genome contig ID gi65550231f_22584175
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CCCTGCTGGCAACAATTAAAGCAAATCTGAAGCAT
Flanking genome sequence
(103754 - 103803)
----+----*----+----*----+----*----+----*----+----*
AGCTTGTGACCTAGAGTGTGAACTTGGGCAAGGTCTCCCTGTCCTCTGTC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 504..2360
Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB23677	100.0	unnamed protein...	Mus musculus
P70389	99.8	Insulin-like gr...	Mus musculus
EDL22372	99.0	insulin-like gr...	Mus musculus
AAF69480	99.0	Als splice vari...	Mus musculus
EDM03884	93.2	insulin-like gr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122338	1.9e-26	32.1	mKIAA0644
AK122278	1.7e-20	35.8	mKIAA0416
BC049775	1.7e-14	31.3	mKIAA0862
AK220546	5.6e-12	33.1	mKIAA4208
AK173296	6.7e-12	25.9	mKIAA1910

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 284 297 PR00019 Leucine-rich repeat

IPR001611 449 462 PR00019 Leucine-rich repeat

HMMPfam IPR000372 56 89 PF01462 Cysteine-rich flanking region

IPR001611 91 114 PF00560 Leucine-rich repeat

IPR001611 115 138 PF00560 Leucine-rich repeat

IPR001611 139 162 PF00560 Leucine-rich repeat

IPR001611 163 186 PF00560 Leucine-rich repeat

IPR001611 187 210 PF00560 Leucine-rich repeat

IPR001611 211 234 PF00560 Leucine-rich repeat

IPR001611 235 258 PF00560 Leucine-rich repeat

IPR001611 259 282 PF00560 Leucine-rich repeat

IPR001611 283 306 PF00560 Leucine-rich repeat

IPR001611 307 330 PF00560 Leucine-rich repeat

IPR001611 331 354 PF00560 Leucine-rich repeat

IPR001611 355 378 PF00560 Leucine-rich repeat

IPR001611 379 402 PF00560 Leucine-rich repeat

IPR001611 403 426 PF00560 Leucine-rich repeat

IPR001611 427 450 PF00560 Leucine-rich repeat

IPR001611 451 474 PF00560 Leucine-rich repeat

IPR001611 475 498 PF00560 Leucine-rich repeat

IPR001611 499 522 PF00560 Leucine-rich repeat

IPR001611 523 547 PF00560 Leucine-rich repeat

HMMSmart IPR000372 56 94 SM00013 Cysteine-rich flanking region

IPR003591 93 112 SM00369 Leucine-rich repeat

IPR003591 113 136 SM00369 Leucine-rich repeat

NULL 137 159 SM00366 NULL

IPR003591 137 160 SM00369 Leucine-rich repeat

IPR003591 161 184 SM00369 Leucine-rich repeat

NULL 185 207 SM00366 NULL

IPR003591 185 208 SM00369 Leucine-rich repeat

NULL 209 232 SM00366 NULL

IPR003591 209 232 SM00369 Leucine-rich repeat

NULL 233 255 SM00366 NULL

IPR003591 233 256 SM00369 Leucine-rich repeat

NULL 257 280 SM00366 NULL

IPR003591 257 280 SM00369 Leucine-rich repeat

NULL 281 304 SM00366 NULL

IPR003591 281 304 SM00369 Leucine-rich repeat

NULL 305 328 SM00366 NULL

IPR003591 305 328 SM00369 Leucine-rich repeat

IPR003591 329 352 SM00369 Leucine-rich repeat

NULL 353 375 SM00366 NULL

IPR003591 353 376 SM00369 Leucine-rich repeat

IPR003591 377 400 SM00369 Leucine-rich repeat

IPR003591 401 424 SM00369 Leucine-rich repeat

NULL 425 447 SM00366 NULL

IPR003591 425 448 SM00369 Leucine-rich repeat

NULL 449 471 SM00366 NULL

IPR003591 449 472 SM00369 Leucine-rich repeat

NULL 473 495 SM00366 NULL

IPR003591 473 496 SM00369 Leucine-rich repeat

IPR003591 497 520 SM00369 Leucine-rich repeat

NULL 521 543 SM00366 NULL

IPR003591 521 546 SM00369 Leucine-rich repeat

IPR000483 551 598 SM00082 Cysteine-rich flanking region

ProfileScan IPR003591 98 169 PS50506 Leucine-rich repeat

NULL 113 548 PS50319 NULL

IPR003591 194 265 PS50506 Leucine-rich repeat

IPR003591 266 337 PS50506 Leucine-rich repeat

IPR003591 338 409 PS50506 Leucine-rich repeat

IPR003591 458 529 PS50506 Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 21 42 TGSPALVVLLAFWVALGPCYLQ

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	284	297	PR00019	Leucine-rich repeat
IPR001611	449	462	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	56	89	PF01462	Cysteine-rich flanking region
IPR001611	91	114	PF00560	Leucine-rich repeat
IPR001611	115	138	PF00560	Leucine-rich repeat
IPR001611	139	162	PF00560	Leucine-rich repeat
IPR001611	163	186	PF00560	Leucine-rich repeat
IPR001611	187	210	PF00560	Leucine-rich repeat
IPR001611	211	234	PF00560	Leucine-rich repeat
IPR001611	235	258	PF00560	Leucine-rich repeat
IPR001611	259	282	PF00560	Leucine-rich repeat
IPR001611	283	306	PF00560	Leucine-rich repeat
IPR001611	307	330	PF00560	Leucine-rich repeat
IPR001611	331	354	PF00560	Leucine-rich repeat
IPR001611	355	378	PF00560	Leucine-rich repeat
IPR001611	379	402	PF00560	Leucine-rich repeat
IPR001611	403	426	PF00560	Leucine-rich repeat
IPR001611	427	450	PF00560	Leucine-rich repeat
IPR001611	451	474	PF00560	Leucine-rich repeat
IPR001611	475	498	PF00560	Leucine-rich repeat
IPR001611	499	522	PF00560	Leucine-rich repeat
IPR001611	523	547	PF00560	Leucine-rich repeat
HMMSmart	IPR000372	56	94	SM00013	Cysteine-rich flanking region
IPR003591	93	112	SM00369	Leucine-rich repeat
IPR003591	113	136	SM00369	Leucine-rich repeat
NULL	137	159	SM00366	NULL
IPR003591	137	160	SM00369	Leucine-rich repeat
IPR003591	161	184	SM00369	Leucine-rich repeat
NULL	185	207	SM00366	NULL
IPR003591	185	208	SM00369	Leucine-rich repeat
NULL	209	232	SM00366	NULL
IPR003591	209	232	SM00369	Leucine-rich repeat
NULL	233	255	SM00366	NULL
IPR003591	233	256	SM00369	Leucine-rich repeat
NULL	257	280	SM00366	NULL
IPR003591	257	280	SM00369	Leucine-rich repeat
NULL	281	304	SM00366	NULL
IPR003591	281	304	SM00369	Leucine-rich repeat
NULL	305	328	SM00366	NULL
IPR003591	305	328	SM00369	Leucine-rich repeat
IPR003591	329	352	SM00369	Leucine-rich repeat
NULL	353	375	SM00366	NULL
IPR003591	353	376	SM00369	Leucine-rich repeat
IPR003591	377	400	SM00369	Leucine-rich repeat
IPR003591	401	424	SM00369	Leucine-rich repeat
NULL	425	447	SM00366	NULL
IPR003591	425	448	SM00369	Leucine-rich repeat
NULL	449	471	SM00366	NULL
IPR003591	449	472	SM00369	Leucine-rich repeat
NULL	473	495	SM00366	NULL
IPR003591	473	496	SM00369	Leucine-rich repeat
IPR003591	497	520	SM00369	Leucine-rich repeat
NULL	521	543	SM00366	NULL
IPR003591	521	546	SM00369	Leucine-rich repeat
IPR000483	551	598	SM00082	Cysteine-rich flanking region
ProfileScan	IPR003591	98	169	PS50506	Leucine-rich repeat
NULL	113	548	PS50319	NULL
IPR003591	194	265	PS50506	Leucine-rich repeat
IPR003591	266	337	PS50506	Leucine-rich repeat
IPR003591	338	409	PS50506	Leucine-rich repeat
IPR003591	458	529	PS50506	Leucine-rich repeat

Method	From	To	amino acid sequence
SOSUI	21	42	TGSPALVVLLAFWVALGPCYLQ

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	262 bp
Genome contig ID	gi65550231f_22584175
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCCTGCTGGCAACAATTAAAGCAAATCTGAAGCAT
Flanking genome sequence (103754 - 103803)	----+--------+--------+--------+--------+----* AGCTTGTGACCTAGAGTGTGAACTTGGGCAAGGTCTCCCTGTCCTCTGTC

Gene/Protein Characteristic Table for mKIAA4111

Features of the cloned DNA sequence

Features of the protein sequence