ROUGE

Gene/Protein Characteristic Table for mKIAA0131

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129060
Description :
Clone Name :	mbh03533 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3823 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 377 bp

Genome contig ID gi66880665r_68455015
PolyA signal sequence
(AATACA,-26)
+----*----+----*----+----*----+----
GCTCTCAAAAATACAGTCTTGGTTGCTTATATCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATTCCTGAACATAGGTATGTCTATGGGTGTGCGAATCTTTGTATTTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0131 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0131	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 551..1693, 1782..3446
Length: 935 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO66338	95.2	Rho GTPase-acti...	Mus musculus
AAL57498	95.2	rho GTPase-acti...	Mus musculus
CAO78108	94.2	Rho GTPase acti...	Mus musculus
EDL85005	86.9	Rho GTPase acti...	Rattus norvegicus
EDL85006	86.0	Rho GTPase acti...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122276	3.5e-27	47.3	mKIAA0411
AK173242	6.9e-11	23.3	mKIAA1722
AK173187	1.3e-10	32.0	mKIAA1501
AK129345	3.5e-10	25.9	mKIAA1391
AK129034	7.9e-09	26.7	mKIAA0013

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 742 792 PD000066 SH3

FPrintScan IPR001452 754 769 PR00452 SH3

IPR001452 771 780 PR00452 SH3

IPR001452 782 794 PR00452 SH3

HMMPfam IPR001060 1 103 PF00611 Cdc15/Fes/CIP4

IPR000198 512 665 PF00620 RhoGAP

IPR001452 740 794 PF00018 SH3

IPR011511 741 794 PF07653 Variant SH3

HMMSmart IPR001060 1 103 SM00055 Cdc15/Fes/CIP4

IPR000198 509 683 SM00324 RhoGAP

IPR001452 740 795 SM00326 SH3

ProfileScan IPR001060 1 68 PS50133 Cdc15/Fes/CIP4

NULL 182 199 PS50325 NULL

IPR000198 512 657 PS50238 RhoGAP

IPR001452 737 796 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	742	792	PD000066	SH3
FPrintScan	IPR001452	754	769	PR00452	SH3
IPR001452	771	780	PR00452	SH3
IPR001452	782	794	PR00452	SH3
HMMPfam	IPR001060	1	103	PF00611	Cdc15/Fes/CIP4
IPR000198	512	665	PF00620	RhoGAP
IPR001452	740	794	PF00018	SH3
IPR011511	741	794	PF07653	Variant SH3
HMMSmart	IPR001060	1	103	SM00055	Cdc15/Fes/CIP4
IPR000198	509	683	SM00324	RhoGAP
IPR001452	740	795	SM00326	SH3
ProfileScan	IPR001060	1	68	PS50133	Cdc15/Fes/CIP4
NULL	182	199	PS50325	NULL
IPR000198	512	657	PS50238	RhoGAP
IPR001452	737	796	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	377 bp
Genome contig ID	gi66880665r_68455015
PolyA signal sequence (AATACA,-26)	+--------+--------+----*----+---- GCTCTCAAAAATACAGTCTTGGTTGCTTATATCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTCCTGAACATAGGTATGTCTATGGGTGTGCGAATCTTTGTATTTCA

Gene/Protein Characteristic Table for mKIAA0131

Features of the cloned DNA sequence

Features of the protein sequence