ROUGE

Gene/Protein Characteristic Table for mKIAA0393

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220338
Description :	hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2.
Clone Name :	mbg13346 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6282 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 664 bp

Genome contig ID gi65511124f_50350612
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AAATTTTAATCCCCTATAAATAAAACATGTGTCAC
Flanking genome sequence
(150664 - 150713)
----+----*----+----*----+----*----+----*----+----*
AAAACTGTAGGCTGAATTTCTTAACCAATTAGACTAGCACATGTGGATCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0393 DNA sequence

KIAA	Alignment based on:
KIAA0393	DNA sequence

Features of the protein sequence	Description

Coding region: 3..5615
Length: 1871 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_034548	99.9	hect (homologou...	Mus musculus
EDL21869	99.9	hect (homologou...	Mus musculus
EDL21868	99.9	hect (homologou...	Mus musculus
Q4U2R1	99.6	Probable E3 ubi...	Mus musculus
AAD08658	99.6	Herc2 [Mus musc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC043082	3.1e-27	36.5	mKIAA1593
AK220164	1.3e-22	29.4	mKIAA4011
AB093227	2.1e-20	28.2	mKIAA0312
AK122203	1.6e-18	26.8	mKIAA0093
AK122192	5.7e-17	24.0	mKIAA0032

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000408 46 98 PF00415 Regulator of chromosome condensation

IPR000408 101 150 PF00415 Regulator of chromosome condensation

IPR000408 153 204 PF00415 Regulator of chromosome condensation

IPR000408 207 256 PF00415 Regulator of chromosome condensation

IPR000408 259 308 PF00415 Regulator of chromosome condensation

IPR000408 311 360 PF00415 Regulator of chromosome condensation

IPR000408 1040 1091 PF00415 Regulator of chromosome condensation

IPR000408 1094 1143 PF00415 Regulator of chromosome condensation

IPR000408 1146 1197 PF00415 Regulator of chromosome condensation

IPR000408 1200 1249 PF00415 Regulator of chromosome condensation

IPR000408 1252 1301 PF00415 Regulator of chromosome condensation

IPR000408 1304 1353 PF00415 Regulator of chromosome condensation

IPR000569 1524 1827 PF00632 HECT

HMMSmart IPR000569 1490 1836 SM00119 HECT

ProfileScan IPR000408 1 46 PS50012 Regulator of chromosome condensation

IPR000408 47 101 PS50012 Regulator of chromosome condensation

IPR000408 102 153 PS50012 Regulator of chromosome condensation

IPR000408 154 205 PS50012 Regulator of chromosome condensation

IPR000408 208 259 PS50012 Regulator of chromosome condensation

IPR000408 260 311 PS50012 Regulator of chromosome condensation

IPR000408 312 363 PS50012 Regulator of chromosome condensation

IPR000408 989 1040 PS50012 Regulator of chromosome condensation

IPR000408 1041 1094 PS50012 Regulator of chromosome condensation

IPR000408 1095 1146 PS50012 Regulator of chromosome condensation

IPR000408 1147 1198 PS50012 Regulator of chromosome condensation

IPR000408 1201 1252 PS50012 Regulator of chromosome condensation

IPR000408 1253 1304 PS50012 Regulator of chromosome condensation

IPR000408 1305 1356 PS50012 Regulator of chromosome condensation

IPR000569 1494 1831 PS50237 HECT

ScanRegExp IPR000719 60 85 PS00107 Protein kinase

IPR000408 140 150 PS00626 Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000408	46	98	PF00415	Regulator of chromosome condensation
IPR000408	101	150	PF00415	Regulator of chromosome condensation
IPR000408	153	204	PF00415	Regulator of chromosome condensation
IPR000408	207	256	PF00415	Regulator of chromosome condensation
IPR000408	259	308	PF00415	Regulator of chromosome condensation
IPR000408	311	360	PF00415	Regulator of chromosome condensation
IPR000408	1040	1091	PF00415	Regulator of chromosome condensation
IPR000408	1094	1143	PF00415	Regulator of chromosome condensation
IPR000408	1146	1197	PF00415	Regulator of chromosome condensation
IPR000408	1200	1249	PF00415	Regulator of chromosome condensation
IPR000408	1252	1301	PF00415	Regulator of chromosome condensation
IPR000408	1304	1353	PF00415	Regulator of chromosome condensation
IPR000569	1524	1827	PF00632	HECT
HMMSmart	IPR000569	1490	1836	SM00119	HECT
ProfileScan	IPR000408	1	46	PS50012	Regulator of chromosome condensation
IPR000408	47	101	PS50012	Regulator of chromosome condensation
IPR000408	102	153	PS50012	Regulator of chromosome condensation
IPR000408	154	205	PS50012	Regulator of chromosome condensation
IPR000408	208	259	PS50012	Regulator of chromosome condensation
IPR000408	260	311	PS50012	Regulator of chromosome condensation
IPR000408	312	363	PS50012	Regulator of chromosome condensation
IPR000408	989	1040	PS50012	Regulator of chromosome condensation
IPR000408	1041	1094	PS50012	Regulator of chromosome condensation
IPR000408	1095	1146	PS50012	Regulator of chromosome condensation
IPR000408	1147	1198	PS50012	Regulator of chromosome condensation
IPR000408	1201	1252	PS50012	Regulator of chromosome condensation
IPR000408	1253	1304	PS50012	Regulator of chromosome condensation
IPR000408	1305	1356	PS50012	Regulator of chromosome condensation
IPR000569	1494	1831	PS50237	HECT
ScanRegExp	IPR000719	60	85	PS00107	Protein kinase
IPR000408	140	150	PS00626	Regulator of chromosome condensation

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	664 bp
Genome contig ID	gi65511124f_50350612
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AAATTTTAATCCCCTATAAATAAAACATGTGTCAC
Flanking genome sequence (150664 - 150713)	----+--------+--------+--------+--------+----* AAAACTGTAGGCTGAATTTCTTAACCAATTAGACTAGCACATGTGGATCT

Gene/Protein Characteristic Table for mKIAA0393

Features of the cloned DNA sequence

Features of the protein sequence