ROUGE

Gene/Protein Characteristic Table for mKIAA0433

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129140
Description :
Clone Name :	mpg00622 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5387 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1558 bp

Genome contig ID gi65488608r_97386247
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TAAGTGGAATGAATTAAAATTCTTTTTAGAATAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGACTTGAATTTAAAGCATTTTATTTGTGTTCTTTCTTTTATGTTTTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0433 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0433	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 431..3829
Length: 1132 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZQB6	100.0	Inositol hexaki...	Mus musculus
EDL39901	99.7	histidine acid ...	Mus musculus
NP_776121	99.9	histidine acid ...	Mus musculus
AAH53396	99.6	Histidine acid ...	Mus musculus
EDL91854	97.0	rCG55411, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122264	0	65.6	mKIAA0377

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000560 388 903 PF00328 Histidine acid phosphatase

ScanRegExp IPR000560 389 403 PS00616 Histidine acid phosphatase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000560	388	903	PF00328	Histidine acid phosphatase
ScanRegExp	IPR000560	389	403	PS00616	Histidine acid phosphatase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1558 bp
Genome contig ID	gi65488608r_97386247
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TAAGTGGAATGAATTAAAATTCTTTTTAGAATAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGACTTGAATTTAAAGCATTTTATTTGTGTTCTTTCTTTTATGTTTTG

Gene/Protein Characteristic Table for mKIAA0433

Features of the cloned DNA sequence

Features of the protein sequence