ROUGE

Gene/Protein Characteristic Table for mKIAA0323

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122247
Description :	Similar to HCDI protein.
Clone Name :	mbg03489 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5880 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4069 bp

Genome contig ID gi65540054f_50303034
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CTCATAAAGTTGTAAGGATTAAATAATATGTATAT
Flanking genome sequence
(113758 - 113807)
----+----*----+----*----+----*----+----*----+----*
AATAGTATGGTGGCTACTACTCATTTTAATTGTTTGCAATTGTGTGGTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0323 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0323	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1808, 1869..2219
Length: 718 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL36230	0	99.4	RIKEN cDNA 9130...	Mus musculus
BAC27665	2e-193	99.8	unnamed protein...	Mus musculus
CAD61924	5.1e-185	79.4	unnamed protein...	Homo sapiens
BAF84369	4.3e-184	79.1	unnamed protein...	Homo sapiens
AAI51401	7e-184	78.7	LOC100124517 pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220380	1.4e-28	64.2	mKIAA1305
AK172981	1.7e-25	31.4	mKIAA0615
AK220416	6.8e-15	48.0	mKIAA1726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 397 412 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	397	412	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4069 bp
Genome contig ID	gi65540054f_50303034
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CTCATAAAGTTGTAAGGATTAAATAATATGTATAT
Flanking genome sequence (113758 - 113807)	----+--------+--------+--------+--------+----* AATAGTATGGTGGCTACTACTCATTTTAATTGTTTGCAATTGTGTGGTCT

Gene/Protein Characteristic Table for mKIAA0323

Features of the cloned DNA sequence

Features of the protein sequence