Gene/Protein Characteristic Table for mKIAA0316

Length: 6390 bp

Restriction map

Length of 3'UTR	3992 bp
Genome contig ID	gi66880665r_160970818
PolyA signal sequence (AATAAA,-10)	+----*----+----*----+----*----+---- ATAATTTTAAATAAATAAATAAACAAATAAACAAG
Flanking genome sequence (99894 - 99845)	----+----*----+----*----+----*----+----*----+----* CATAAGCCTGGTGCATGTATGCAAATACCGTCACAGGTAGCGTTGCATTC

KIAA	Alignment based on:
KIAA0316	DNA sequence, AA sequence, Physical map

Coding region: 2..2395, 2398..3723

Length: 1239 aa

Entry Exp ID% Protein Source EDL40706 0 99.8 mCG115771 [Mus ... Mus musculus XP_586585 0 82.3 similar to FERM... Bos taurus BAE27913 0 100.0 unnamed protein... Mus musculus BAE27868 0 100.0 unnamed protein... Mus musculus A2AFR3 0 100.0 FERM and PDZ do... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122409 0.001 20.7 mKIAA0967

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-