ROUGE

Gene/Protein Characteristic Table for mKIAA0967

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122409
Description :
Clone Name :	mbh02135 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4439 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 107 bp

Genome contig ID gi65493515f_45060554
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATAGAGTATTCAAATAAACTGCTGCTTAATCTTGA
Flanking genome sequence
(141307 - 141356)
----+----*----+----*----+----*----+----*----+----*
TCTTGTTCTGCCTTTCGAGTTCTGAGTGATGGTAAATTTGGATTTAAAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0967 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0967	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..4332
Length: 1443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2AKB4	99.0	FERM and PDZ do...	Mus musculus
AAI58061	99.0	FERM and PDZ do...	Mus musculus
AAH31840	98.8	Frmpd1 protein ...	Mus musculus
AAH46469	98.4	Frmpd1 protein ...	Mus musculus
XP_001504324	73.9	similar to FERM...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220543	4.2e-05	24.7	mKIAA4203

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000159 73 161 PF00788 RA

HMMSmart IPR000299 71 295 SM00295 Band 4.1

ProfileScan IPR000299 72 319 PS50057 Band 4.1

IPR000159 73 163 PS50200 RA

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	73	161	PF00788	RA
HMMSmart	IPR000299	71	295	SM00295	Band 4.1
ProfileScan	IPR000299	72	319	PS50057	Band 4.1
IPR000159	73	163	PS50200	RA

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	107 bp
Genome contig ID	gi65493515f_45060554
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATAGAGTATTCAAATAAACTGCTGCTTAATCTTGA
Flanking genome sequence (141307 - 141356)	----+--------+--------+--------+--------+----* TCTTGTTCTGCCTTTCGAGTTCTGAGTGATGGTAAATTTGGATTTAAAAT

Gene/Protein Characteristic Table for mKIAA0967

Features of the cloned DNA sequence

Features of the protein sequence