ROUGE

Gene/Protein Characteristic Table for mKIAA0266

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172924
Description :
Clone Name :	mtk02208 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 2431 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 118 bp

Genome contig ID gi66880665f_42679136
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ATATCTGAGAAATAAAGGCATTTTTTTTTACCTTT
Flanking genome sequence
(124112 - 124161)
----+----*----+----*----+----*----+----*----+----*
ATAACTCGACTACCTTCTGTATTATCTATTTCCCTGTTGAATCTTCAGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0266 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0266	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2313
Length: 770 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q640M1	0	100.0	U3 small nucleo...	Mus musculus
BAE22282	0	99.7	unnamed protein...	Mus musculus
AAQ87011	0	99.0	Jsd-like X-link...	Mus musculus
AAH99799	0	88.3	UTP14, U3 small...	Rattus norvegicus
EDL29072	6.9e-200	100.0	UTP14, U3 small...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006709 34 736 PF04615 Utp14 protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006709	34	736	PF04615	Utp14 protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	118 bp
Genome contig ID	gi66880665f_42679136
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATATCTGAGAAATAAAGGCATTTTTTTTTACCTTT
Flanking genome sequence (124112 - 124161)	----+--------+--------+--------+--------+----* ATAACTCGACTACCTTCTGTATTATCTATTTCCCTGTTGAATCTTCAGGG

Gene/Protein Characteristic Table for mKIAA0266

Features of the cloned DNA sequence

Features of the protein sequence