ROUGE

Gene/Protein Characteristic Table for mKIAA0259

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129104
Description :	topoisomerase (DNA) II beta binding protein.
Clone Name :	mpm11192 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5228 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 516 bp

Genome contig ID gi65519420f_103180657
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GATAAAGAATAAAAAAAAATAGCAACTTAAACTGT
Flanking genome sequence
(145219 - 145268)
----+----*----+----*----+----*----+----*----+----*
ATTGATTTGTTCATTTAGATCTGTTGATATGCCAGACTTAAAAGCTGTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0259 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0259	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..4712
Length: 1569 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZQF0	100.0	DNA topoisomera...	Mus musculus
XP_236578	91.7	similar to topo...	Rattus norvegicus
AAH07170	99.5	Topbp1 protein ...	Mus musculus
XP_534266	76.7	similar to DNA ...	Canis lupus fam...
XP_516761	76.4	topoisomerase (...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220452	3.3e-13	29.5	mKIAA4037

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001357 155 230 PF00533 BRCT

IPR001357 249 325 PF00533 BRCT

IPR001357 407 484 PF00533 BRCT

IPR001357 698 782 PF00533 BRCT

IPR001357 956 1034 PF00533 BRCT

IPR001357 1310 1388 PF00533 BRCT

HMMSmart IPR001357 60 145 SM00292 BRCT

IPR001357 157 233 SM00292 BRCT

IPR001357 251 328 SM00292 BRCT

IPR001357 409 487 SM00292 BRCT

IPR001357 607 680 SM00292 BRCT

IPR001357 700 785 SM00292 BRCT

IPR001357 958 1037 SM00292 BRCT

IPR001357 1312 1391 SM00292 BRCT

ProfileScan IPR001357 155 226 PS50172 BRCT

IPR001357 249 338 PS50172 BRCT

IPR001357 407 497 PS50172 BRCT

IPR001357 698 795 PS50172 BRCT

IPR001357 956 1047 PS50172 BRCT

IPR000694 1261 1300 PS50099 Proline-rich region

IPR001357 1309 1401 PS50172 BRCT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001357	155	230	PF00533	BRCT
IPR001357	249	325	PF00533	BRCT
IPR001357	407	484	PF00533	BRCT
IPR001357	698	782	PF00533	BRCT
IPR001357	956	1034	PF00533	BRCT
IPR001357	1310	1388	PF00533	BRCT
HMMSmart	IPR001357	60	145	SM00292	BRCT
IPR001357	157	233	SM00292	BRCT
IPR001357	251	328	SM00292	BRCT
IPR001357	409	487	SM00292	BRCT
IPR001357	607	680	SM00292	BRCT
IPR001357	700	785	SM00292	BRCT
IPR001357	958	1037	SM00292	BRCT
IPR001357	1312	1391	SM00292	BRCT
ProfileScan	IPR001357	155	226	PS50172	BRCT
IPR001357	249	338	PS50172	BRCT
IPR001357	407	497	PS50172	BRCT
IPR001357	698	795	PS50172	BRCT
IPR001357	956	1047	PS50172	BRCT
IPR000694	1261	1300	PS50099	Proline-rich region
IPR001357	1309	1401	PS50172	BRCT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	516 bp
Genome contig ID	gi65519420f_103180657
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GATAAAGAATAAAAAAAAATAGCAACTTAAACTGT
Flanking genome sequence (145219 - 145268)	----+--------+--------+--------+--------+----* ATTGATTTGTTCATTTAGATCTGTTGATATGCCAGACTTAAAAGCTGTCT

Gene/Protein Characteristic Table for mKIAA0259

Features of the cloned DNA sequence

Features of the protein sequence