ROUGE

Gene/Protein Characteristic Table for mKIAA0237

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122226
Description :	Regulating synaptic membrane exocytosis protein 3.
Clone Name :	mbg11214 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5865 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5073 bp

Genome contig ID gi65493515f_119800446
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AAACAAAAAAATAAAGTCCATTTGAAATTGGTTTT
Flanking genome sequence
(118580 - 118629)
----+----*----+----*----+----*----+----*----+----*
ATGTATGGCTTTCTGAGGATGTTCTTCATTCCAAGAGAGAAGAGTTCTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0237 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0237	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..792
Length: 263 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80U57	4.1e-108	100.0	Regulating syna...	Mus musculus
EDL80347	9e-108	99.6	regulating syna...	Rattus norvegicus
Q9JIR3	1.7e-107	99.2	Regulating syna...	Rattus norvegicus
XP_001503313	8.6e-106	97.7	similar to Regu...	Equus caballus
Q9UJD0	8.6e-106	97.7	Regulating syna...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129206	5.3e-72	71.6	mKIAA0751
AK131174	2.3e-06	23.0	mFLJ00307
AK220537	0.00012	31.3	mKIAA4194
AK173212	0.00049	24.3	mKIAA1597
AK220218	0.0005	26.6	mKIAA0538

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 126 213 PF00168 C2

HMMSmart IPR000008 125 228 SM00239 C2

ProfileScan IPR000008 123 213 PS50004 C2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	126	213	PF00168	C2
HMMSmart	IPR000008	125	228	SM00239	C2
ProfileScan	IPR000008	123	213	PS50004	C2

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5073 bp
Genome contig ID	gi65493515f_119800446
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAACAAAAAAATAAAGTCCATTTGAAATTGGTTTT
Flanking genome sequence (118580 - 118629)	----+--------+--------+--------+--------+----* ATGTATGGCTTTCTGAGGATGTTCTTCATTCCAAGAGAGAAGAGTTCTGA

Gene/Protein Characteristic Table for mKIAA0237

Features of the cloned DNA sequence

Features of the protein sequence