ROUGE

Gene/Protein Characteristic Table for mKIAA0211

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129089
Description :	Zinc finger protein 592.
Clone Name :	mpm11220 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4821 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 856 bp

Genome contig ID gi65511124f_74712133
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GACTATATTTCAATAAAAAAAAAATCTTACCATGC
Flanking genome sequence
(133290 - 133339)
----+----*----+----*----+----*----+----*----+----*
AGGTAGGCTCTTGTATTCCTCTTCTGGTGAGCTAGCCCTTCCCTGCTCCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0211 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0211	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 87..3965
Length: 1292 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BHZ4	100.0	Zinc finger pro...	Mus musculus
EDL06960	99.9	zinc finger pro...	Mus musculus
BAE25468	99.7	unnamed protein...	Mus musculus
AAI18973	99.9	Zinc finger pro...	Mus musculus
BAC31327	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129360	8.9e-13	36.9	mKIAA1441
AK129410	7.9e-10	38.4	mKIAA1629

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 922 945 PF00096 Zinc finger

IPR007087 1043 1066 PF00096 Zinc finger

IPR007087 1183 1206 PF00096 Zinc finger

HMMSmart IPR007087 617 642 SM00355 Zinc finger

IPR007087 645 669 SM00355 Zinc finger

IPR007087 741 761 SM00355 Zinc finger

IPR007087 770 792 SM00355 Zinc finger

IPR007087 798 822 SM00355 Zinc finger

IPR007087 829 852 SM00355 Zinc finger

IPR007087 857 880 SM00355 Zinc finger

IPR007087 922 945 SM00355 Zinc finger

IPR007087 1013 1036 SM00355 Zinc finger

IPR007087 1043 1066 SM00355 Zinc finger

IPR007087 1073 1099 SM00355 Zinc finger

IPR007087 1154 1176 SM00355 Zinc finger

IPR007087 1183 1206 SM00355 Zinc finger

ProfileScan IPR007087 617 642 PS50157 Zinc finger

IPR007087 770 797 PS50157 Zinc finger

IPR007087 922 950 PS50157 Zinc finger

IPR007087 1043 1071 PS50157 Zinc finger

ScanRegExp IPR007087 772 794 PS00028 Zinc finger

IPR007087 859 880 PS00028 Zinc finger

IPR007087 924 945 PS00028 Zinc finger

IPR007087 1015 1036 PS00028 Zinc finger

IPR007087 1045 1066 PS00028 Zinc finger

IPR007087 1185 1206 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	922	945	PF00096	Zinc finger
IPR007087	1043	1066	PF00096	Zinc finger
IPR007087	1183	1206	PF00096	Zinc finger
HMMSmart	IPR007087	617	642	SM00355	Zinc finger
IPR007087	645	669	SM00355	Zinc finger
IPR007087	741	761	SM00355	Zinc finger
IPR007087	770	792	SM00355	Zinc finger
IPR007087	798	822	SM00355	Zinc finger
IPR007087	829	852	SM00355	Zinc finger
IPR007087	857	880	SM00355	Zinc finger
IPR007087	922	945	SM00355	Zinc finger
IPR007087	1013	1036	SM00355	Zinc finger
IPR007087	1043	1066	SM00355	Zinc finger
IPR007087	1073	1099	SM00355	Zinc finger
IPR007087	1154	1176	SM00355	Zinc finger
IPR007087	1183	1206	SM00355	Zinc finger
ProfileScan	IPR007087	617	642	PS50157	Zinc finger
IPR007087	770	797	PS50157	Zinc finger
IPR007087	922	950	PS50157	Zinc finger
IPR007087	1043	1071	PS50157	Zinc finger
ScanRegExp	IPR007087	772	794	PS00028	Zinc finger
IPR007087	859	880	PS00028	Zinc finger
IPR007087	924	945	PS00028	Zinc finger
IPR007087	1015	1036	PS00028	Zinc finger
IPR007087	1045	1066	PS00028	Zinc finger
IPR007087	1185	1206	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	856 bp
Genome contig ID	gi65511124f_74712133
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GACTATATTTCAATAAAAAAAAAATCTTACCATGC
Flanking genome sequence (133290 - 133339)	----+--------+--------+--------+--------+----* AGGTAGGCTCTTGTATTCCTCTTCTGGTGAGCTAGCCCTTCCCTGCTCCA

Gene/Protein Characteristic Table for mKIAA0211

Features of the cloned DNA sequence

Features of the protein sequence