ROUGE |
Gene/Protein Characteristic Table for mKIAA0210 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220251 |
---|---|
TBC1 domain family, member 5. | |
mic20042 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5579 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2814 bp Genome contig ID gi65550231r_48165633 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GCCCACTTGATGTGTACTAATAAAGGACTACTGAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTGGGATCACATCCACTTCTTCCAGTCACATAGCTCTGGGGTCCGGAG
KIAA Alignment based on: KIAA0210 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 300..2765
Length: 821 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000195 | 128 | 389 | PF00566 | RabGAP/TBC |
HMMSmart | IPR000195 | 84 | 390 | SM00164 | RabGAP/TBC |
ProfileScan | IPR000195 | 81 | 362 | PS50086 | RabGAP/TBC |
NULL | 516 | 545 | PS50322 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |