ROUGE

Gene/Protein Characteristic Table for mKIAA0170

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129074
Description :
Clone Name :	mpg00547 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5109 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2061 bp

Genome contig ID gi65550231f_33468268
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATGAATTTCACTTCAATAAAAAAGTTGCTTACTTT
Flanking genome sequence
(109378 - 109427)
----+----*----+----*----+----*----+----*----+----*
ATATTTTCCTGCAGTGAATTATGTATAAGCTTAGAGAACTATTGGTGGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0170 DNA sequence, Physical map

KIAA	Alignment based on:
KIAA0170	DNA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3045
Length: 1015 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH85140	100.0	Mdc1 protein [M...	Mus musculus
AAH94363	100.0	Mdc1 protein [M...	Mus musculus
EDL23237	100.0	mCG141147 [Mus ...	Mus musculus
Q5PSV9	100.0	Mediator of DNA...	Mus musculus
NP_001010833	100.0	mediator of DNA...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 427 437 PR00929 HMG-I and HMG-Y

IPR000637 505 516 PR00929 HMG-I and HMG-Y

IPR000637 546 556 PR00929 HMG-I and HMG-Y

HMMSmart IPR001357 809 886 SM00292 BRCT

IPR001357 919 998 SM00292 BRCT

ProfileScan IPR000694 303 702 PS50099 Proline-rich region

IPR001357 818 896 PS50172 BRCT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	427	437	PR00929	HMG-I and HMG-Y
IPR000637	505	516	PR00929	HMG-I and HMG-Y
IPR000637	546	556	PR00929	HMG-I and HMG-Y
HMMSmart	IPR001357	809	886	SM00292	BRCT
IPR001357	919	998	SM00292	BRCT
ProfileScan	IPR000694	303	702	PS50099	Proline-rich region
IPR001357	818	896	PS50172	BRCT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2061 bp
Genome contig ID	gi65550231f_33468268
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGAATTTCACTTCAATAAAAAAGTTGCTTACTTT
Flanking genome sequence (109378 - 109427)	----+--------+--------+--------+--------+----* ATATTTTCCTGCAGTGAATTATGTATAAGCTTAGAGAACTATTGGTGGTT

Gene/Protein Characteristic Table for mKIAA0170

Features of the cloned DNA sequence

Features of the protein sequence