Order Kazusa clone(s) from : ![]() |
Product ID | ORK00440 |
---|---|
Accession No | D79990 |
Description | Ras association (RalGDS/AF-6) domain family member 2, transcript variant 1 |
Clone name | ha02316 |
Vector information | |
cDNA sequence | DNA sequence (5426 bp) Predicted protein sequence (331 aa) |
HaloTag ORF Clone |
FHC00440
![]() |
Flexi ORF Clone | FXC00440 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0168
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4249 bp |
---|---|
Genome contig ID | gi51511747r_4608670 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 4708670 | 4752291 | 12 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | ATAGCAGCACACATTTTCACG |
Primer_r | TACACACCAGAAACATCAGCC |
PCR product length | 303 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |