ROUGE

Gene/Protein Characteristic Table for mKIAA0141

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172900
Description :
Clone Name :	mej00228 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2326 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 748 bp

Genome contig ID gi65551972f_38374047
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATACAAGTGTTTAATAAAACAGATGGTGGATTATC
Flanking genome sequence
(112304 - 112353)
----+----*----+----*----+----*----+----*----+----*
TCTCGGTCTTGCCCTTGAGTGTGTTGGAGAGAGCCAGGGAGATGGGCAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0141 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0141	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1578
Length: 525 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL10095	4.1e-214	99.8	RIKEN cDNA 0610...	Mus musculus
BAE42690	3.3e-213	99.2	unnamed protein...	Mus musculus
EDL76436	1.8e-196	92.0	SEL1 domain con...	Rattus norvegicus
XP_544318	7.2e-147	71.8	similar to CG10...	Canis lupus fam...
BAF85558	4.3e-146	72.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220502	0.00024	31.6	mKIAA4137

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 261 292 PF08238 NULL

NULL 293 328 PF08238 NULL

NULL 329 366 PF08238 NULL

NULL 367 400 PF08238 NULL

NULL 401 436 PF08238 NULL

ProfileScan IPR001440 261 294 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	261	292	PF08238	NULL
NULL	293	328	PF08238	NULL
NULL	329	366	PF08238	NULL
NULL	367	400	PF08238	NULL
NULL	401	436	PF08238	NULL
ProfileScan	IPR001440	261	294	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	748 bp
Genome contig ID	gi65551972f_38374047
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATACAAGTGTTTAATAAAACAGATGGTGGATTATC
Flanking genome sequence (112304 - 112353)	----+--------+--------+--------+--------+----* TCTCGGTCTTGCCCTTGAGTGTGTTGGAGAGAGCCAGGGAGATGGGCAGG

Gene/Protein Characteristic Table for mKIAA0141

Features of the cloned DNA sequence

Features of the protein sequence