ROUGE

Gene/Protein Characteristic Table for mKIAA4137

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220502
Description :	Sel-1 homolog precursor.
Clone Name :	mbg17504 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5723 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3224 bp

Genome contig ID gi65532617r_87123987
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGAAGTAACCGGAACAAAGGAAAACTATTTTATGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAACTATTTTCATCAGTTATTGCCTCAGATACGA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..2496
Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Z2G6	100.0	Protein sel-1 h...	Mus musculus
EDL81675	96.6	Sel1 (suppresso...	Rattus norvegicus
Q80Z70	95.5	Protein sel-1 h...	Rattus norvegicus
Q9ESM7	94.8	Protein sel-1 h...	Mesocricetus au...
XP_537530	93.2	similar to sel-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122362	7.5e-17	26.9	mKIAA0746
AK016626	0.00033	29.4	mKIAA1325

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000562 156 203 PD000995 Type II fibronectin

FPrintScan IPR000562 162 171 PR00013 Type II fibronectin

IPR000562 173 185 PR00013 Type II fibronectin

IPR000562 190 205 PR00013 Type II fibronectin

HMMPfam IPR000562 165 206 PF00040 Type II fibronectin

NULL 221 256 PF08238 NULL

NULL 257 292 PF08238 NULL

NULL 293 328 PF08238 NULL

NULL 329 364 PF08238 NULL

NULL 411 447 PF08238 NULL

NULL 448 484 PF08238 NULL

NULL 485 520 PF08238 NULL

NULL 521 556 PF08238 NULL

NULL 557 592 PF08238 NULL

NULL 665 700 PF08238 NULL

NULL 702 737 PF08238 NULL

HMMSmart IPR000562 158 206 SM00059 Type II fibronectin

ProfileScan NULL 4 48 PS50323 NULL

IPR000694 808 831 PS50099 Proline-rich region

ScanRegExp IPR000562 165 206 PS00023 Type II fibronectin

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000562	156	203	PD000995	Type II fibronectin
FPrintScan	IPR000562	162	171	PR00013	Type II fibronectin
IPR000562	173	185	PR00013	Type II fibronectin
IPR000562	190	205	PR00013	Type II fibronectin
HMMPfam	IPR000562	165	206	PF00040	Type II fibronectin
NULL	221	256	PF08238	NULL
NULL	257	292	PF08238	NULL
NULL	293	328	PF08238	NULL
NULL	329	364	PF08238	NULL
NULL	411	447	PF08238	NULL
NULL	448	484	PF08238	NULL
NULL	485	520	PF08238	NULL
NULL	521	556	PF08238	NULL
NULL	557	592	PF08238	NULL
NULL	665	700	PF08238	NULL
NULL	702	737	PF08238	NULL
HMMSmart	IPR000562	158	206	SM00059	Type II fibronectin
ProfileScan	NULL	4	48	PS50323	NULL
IPR000694	808	831	PS50099	Proline-rich region
ScanRegExp	IPR000562	165	206	PS00023	Type II fibronectin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 48 64 RLSLLLLCAVLLGSAAA

739 761 AQVPVFLALCKLGVVYFLQYIRE

779 800 PEWDLYLMTIIALLLGTVIAYR

Method	From	To	amino acid sequence
SOSUI	48	64	RLSLLLLCAVLLGSAAA
739	761	AQVPVFLALCKLGVVYFLQYIRE
779	800	PEWDLYLMTIIALLLGTVIAYR

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3224 bp
Genome contig ID	gi65532617r_87123987
PolyA signal sequence (None)	+--------+--------+----*----+---- AGAAGTAACCGGAACAAAGGAAAACTATTTTATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAACTATTTTCATCAGTTATTGCCTCAGATACGA

Gene/Protein Characteristic Table for mKIAA4137

Features of the cloned DNA sequence

Features of the protein sequence