ROUGE

Gene/Protein Characteristic Table for mKIAA0130

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC005409
Description :	thyroid hormone receptor associated protein 4. peroxisome proliferation activation receptor binding protein 2. thyroid hormone receptor-associated protein 100 kDa. thyroid hormone receptor-associated protein 100. genetic suppressor element 2.
Clone Name :	mbr03055 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1118 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 161 bp

Genome contig ID gi65527427r_98425840
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTCTGTCCTTTGAACCAGCACCATCATCCATAATG
Flanking genome sequence
(203022 - 202973)
----+----*----+----*----+----*----+----*----+----*
TATCAAAAGTATGAATTACAGCACAGACAACGATATGAAACGGGCATAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0130 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0130	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..957
Length: 318 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q99K74	5.2e-135	100.0	Mediator of RNA...	Mus musculus
EDL16161	5.2e-135	100.0	thyroid hormone...	Mus musculus
CAO77992	5.3e-135	100.0	mediator comple...	Mus musculus
AAD42776	3.6e-133	98.4	100 kDa thyroid...	Mus musculus
Q4V8B3	3.7e-133	98.1	Mediator of RNA...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	161 bp
Genome contig ID	gi65527427r_98425840
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTGTCCTTTGAACCAGCACCATCATCCATAATG
Flanking genome sequence (203022 - 202973)	----+--------+--------+--------+--------+----* TATCAAAAGTATGAATTACAGCACAGACAACGATATGAAACGGGCATAAA

Gene/Protein Characteristic Table for mKIAA0130

Features of the cloned DNA sequence

Features of the protein sequence