Vector Information
The cDNA fragment was synthesized by application of two-round cRNA
amplification method (Ohara et al., Biotechniques, 38(3), (2005)) using T7-
Not_tagged specific primer for the first-stranded cDNA synthesis during the
first-round cDNA synthesis and the third_round cDNA synthesis. After the
third-round cDNA synthesis, cDNA ends were repaired and ligated with Sal I
adaptor (5'-TCGACCCACGCGTCCG-3'), then the cDNA was digested with Not I
and inserted into the Sal I-Not I sites in the attBpBSIISK(+) vector. The
attBpBSIISK(+) vector was constructed by insertion of the following sequence
into the Sac I-Kpn I sites in pBluescript II SK (+) vector (GenBank Accession No.
X52328):
GAGCTCACCACTTTGTACAAGAAAGCTGGGTGGCGGCCGCTCTAGAACTAGTGG
ATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACAGCCTG
CTTTTTTGTACAAACTTGTGGTACC.