Vector Information

 
The cDNA fragment was synthesized by application of two-round cRNA 
amplification method (Ohara et al., Biotechniques, 38(3), (2005)) using T7-
Not_tagged specific primer for the first-stranded cDNA synthesis during the 
first-round cDNA synthesis and the third_round cDNA synthesis. After the 
third-round cDNA synthesis, cDNA ends were repaired and ligated with Sal I 
adaptor (5'-TCGACCCACGCGTCCG-3'), then the cDNA was digested with Not I 
and inserted into the Sal I-Not I sites in the attBpBSIISK(+) vector.  The 
attBpBSIISK(+) vector was constructed by insertion of the following sequence 
into the Sac I-Kpn I sites in pBluescript II SK (+) vector (GenBank Accession No. 
X52328): 
GAGCTCACCACTTTGTACAAGAAAGCTGGGTGGCGGCCGCTCTAGAACTAGTGG
ATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACAGCCTG
CTTTTTTGTACAAACTTGTGGTACC.