ROUGE

Gene/Protein Characteristic Table for mKIAA0117

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220250
Description :
Clone Name :	mif32059 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 583 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 213 bp

Genome contig ID gi65515060r_126136774
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
AAAAATAATAAACATTAATACTCTGTGTTTAGGAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGTTCAAATGGTCACTGTGAGAATACTGATTCCAGGTATAGTCACAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0117 DNA sequence

KIAA	Alignment based on:
KIAA0117	DNA sequence

Features of the protein sequence	Description

Coding region: 2..367
Length: 122 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL11823	1.3e-43	100.0	RNA binding mot...	Mus musculus
EDL11822	1.3e-43	100.0	RNA binding mot...	Mus musculus
Q5M9F1	2.4e-33	86.9	RNA-binding pro...	Rattus norvegicus
XP_514284	3.9e-28	75.4	RNA binding mot...	Pan troglodytes
CAM28277	5e-27	73.8	novel protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000504 1 48 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

NULL 49 120 PS50318 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000504	1	48	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
NULL	49	120	PS50318	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	213 bp
Genome contig ID	gi65515060r_126136774
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- AAAAATAATAAACATTAATACTCTGTGTTTAGGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGTTCAAATGGTCACTGTGAGAATACTGATTCCAGGTATAGTCACAG

Gene/Protein Characteristic Table for mKIAA0117

Features of the cloned DNA sequence

Features of the protein sequence