ROUGE

Gene/Protein Characteristic Table for mKIAA0103

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172887
Description :
Clone Name :	mpk05323 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1175 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 279 bp

Genome contig ID gi65543215f_43323133
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ACACCTTATTAAATAAACCATGGTTTATTAAACTC
Flanking genome sequence
(150480 - 150529)
----+----*----+----*----+----*----+----*----+----*
ATGTATGAAAATTCTAGTTTCTTTTGTTTTATTGGAATTCGTGTGTTGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0103 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0103	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..896
Length: 297 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
B0BNG0	2.6e-115	98.7	Tetratricopepti...	Rattus norvegicus
XP_001090826	1.1e-113	97.0	hypothetical pr...	Macaca mulatta
Q5R882	1.9e-113	97.0	Tetratricopepti...	Pongo abelii
XP_001495024	2.2e-113	97.3	similar to Tetr...	Equus caballus
BAF83663	2.2e-113	97.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK040578	0.00041	21.8	mKIAA1140

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 87 120 PF07719 NULL

NULL 155 188 PF07719 NULL

ProfileScan IPR001440 87 225 PS50293 TPR repeat

IPR001440 87 120 PS50005 TPR repeat

IPR001440 155 188 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	87	120	PF07719	NULL
NULL	155	188	PF07719	NULL
ProfileScan	IPR001440	87	225	PS50293	TPR repeat
IPR001440	87	120	PS50005	TPR repeat
IPR001440	155	188	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	279 bp
Genome contig ID	gi65543215f_43323133
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACACCTTATTAAATAAACCATGGTTTATTAAACTC
Flanking genome sequence (150480 - 150529)	----+--------+--------+--------+--------+----* ATGTATGAAAATTCTAGTTTCTTTTGTTTTATTGGAATTCGTGTGTTGTT

Gene/Protein Characteristic Table for mKIAA0103

Features of the cloned DNA sequence

Features of the protein sequence