ROUGE

Gene/Protein Characteristic Table for mKIAA0101

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK011090
Description :
Clone Name :	mpk02179 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 899 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 459 bp

Genome contig ID gi65519420f_65913650
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGGGCTATACAGAGAAACCCTGTCTCGAAAAACC
Flanking genome sequence
(111742 - 111791)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAATTGACTTAGTCTTTTTTACATTAAAATTTTCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0101 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0101	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 18..440
Length: 140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL26108	1.3e-55	100.0	mCG131663, isof...	Mus musculus
XP_001472289	4.1e-47	93.2	hypothetical pr...	Mus musculus
Q9CQX4	1.5e-43	100.0	PCNA-associated...	Mus musculus
BAB28650	7.7e-43	99.1	unnamed protein...	Mus musculus
Q6RIA2	6.2e-42	95.5	PCNA-associated...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	459 bp
Genome contig ID	gi65519420f_65913650
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGGGCTATACAGAGAAACCCTGTCTCGAAAAACC
Flanking genome sequence (111742 - 111791)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATTGACTTAGTCTTTTTTACATTAAAATTTTCAA

Gene/Protein Characteristic Table for mKIAA0101

Features of the cloned DNA sequence

Features of the protein sequence