Gene/Protein Characteristic Table for mKIAA0098

Length: 1682 bp

Restriction map

Length of 3'UTR	51 bp
Genome contig ID	gi65543215r_31491484
PolyA signal sequence (AATAAA,-26)	+----*----+----*----+----*----+---- CTGTGACTAAATAAAGGGTGTGTCTGTTGTGCTGC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* GTCTGCAGTTACTGCTGGTCCTCTCACAGCTGTAGATGCTGGAATAAAAG

KIAA	Alignment based on:
KIAA0098	DNA sequence, AA sequence

Coding region: 3..1631

Length: 542 aa

Entry Exp ID% Protein Source P80316 5.2e-216 100.0 T-complex prote... Mus musculus BAE39906 1.1e-215 99.8 unnamed protein... Mus musculus BAE23007 1.5e-215 99.8 unnamed protein... Mus musculus BAE32250 2e-215 99.8 unnamed protein... Mus musculus BAE27146 2.6e-215 99.6 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK172867 4.7e-45 31.3 mKIAA0002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	47	63	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	69	87	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	99	118	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	385	407	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	419	431	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	45	539	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012718	7	538	TIGR02343	T-complex protein 1
ScanRegExp	IPR002194	50	62	PS00750	Chaperonin TCP-1
	IPR002194	71	87	PS00751	Chaperonin TCP-1
	IPR002194	99	107	PS00995	Chaperonin TCP-1

Method	From	To	amino acid sequence
-	-	-	-