KIAA0098

Product ID	ORK00408
Accession No	D43950
Description	chaperonin containing TCP1, subunit 5 (epsilon), transcript variant 1
Clone name	bm00714
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (1891 bp) Predicted protein sequence (553 aa)
HaloTag ORF Clone	FHC00408
Flexi ORF Clone	FXC00408
Source	Human adult brain
Rouge ID	mKIAA0098 by Kazusa Mouse cDNA Project
Note	We replaced ha01413, former representative clones for KIAA0098 with bm00714. (2001/10/06)

Length: 1891 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	228 bp
Genome contig ID	gi51511721f_10203416
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTTGTATTCATTGTATTAAAAGAATCTGTTTAAAC
Flanking genome sequence (114709 - 114758)	----+--------+--------+--------+--------+----* AACCTTTATCTTCTCTTCGGGTTTAAGAAACGTTTATTGTAACAGTAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	10303416	10318123	11	99.5	Perfect prediction

Length: 553 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P48643	1.2e-212	100.0	T-complex prote...	Homo sapiens
AAH02971	7e-212	100.0	Unknown (protei...	Homo sapiens
Q5RF02	7e-212	99.6	T-complex prote...	Pongo abelii
BAF83082	9.4e-212	99.6	unnamed protein...	Homo sapiens
XP_848303	2e-210	98.3	similar to T-co...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13627	1.1e-45	31.6	KIAA0002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	58	74	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	60	86	PR00298	Chaperonin Cpn60
	IPR002423	80	98	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	110	129	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	112	139	PR00298	Chaperonin Cpn60
	IPR002423	396	418	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	416	437	PR00298	Chaperonin Cpn60
	IPR002423	430	442	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	56	550	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012718	18	549	TIGR02343	T-complex protein 1
ScanRegExp	IPR002194	61	73	PS00750	Chaperonin TCP-1
	IPR002194	82	98	PS00751	Chaperonin TCP-1
	IPR002194	110	118	PS00995	Chaperonin TCP-1

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CCCACCTTAGAACAGTATGCC
Primer_r	TCATCTCCTTCACCTGTCTGG
PCR product length	136 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles