ROUGE |
Gene/Protein Characteristic Table for mKIAA0091 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122202 |
---|---|
Membrane-bound transcription factor site-1 protease precursor. | |
mbh04269 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4186 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1159 bp Genome contig ID gi65515060r_118750262 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GGTGAAGGAAATTTTCAATAAATATGCATAACCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACAAAGCTGGCATGTGTCGTGCCCCAGCCCCCTGCACCTTCCCATTCTCT
KIAA Alignment based on: KIAA0091 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 388..3021, 3027..3563
Length: 1056 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |