ROUGE

Gene/Protein Characteristic Table for mKIAA0086

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220214
Description :	DNA cross-link repair 1A, PSO2 homolog. SNM1 protein.
Clone Name :	msh32285 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3287 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 332 bp

Genome contig ID gi65553144r_56014719
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ATATGTATTCTTAAATAAAATTTAATATAGAACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCAGAGCATATTTGGATGGGTTTCATTATTGCCTTATTTTCTTTTTAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0086 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0086	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2955
Length: 984 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9JIC3	0	99.8	DNA cross-link ...	Mus musculus
EDL01762	0	99.4	DNA cross-link ...	Mus musculus
AAF64472	0	97.3	SNM1 protein [M...	Mus musculus
EDL94499	0	83.7	DNA cross-link ...	Rattus norvegicus
EDL01761	4.4e-202	99.2	DNA cross-link ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011084 863 961 PF07522 DNA repair metallo-beta-lactamase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011084	863	961	PF07522	DNA repair metallo-beta-lactamase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	332 bp
Genome contig ID	gi65553144r_56014719
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATATGTATTCTTAAATAAAATTTAATATAGAACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAGAGCATATTTGGATGGGTTTCATTATTGCCTTATTTTCTTTTTAGT

Gene/Protein Characteristic Table for mKIAA0086

Features of the cloned DNA sequence

Features of the protein sequence