ROUGE

Gene/Protein Characteristic Table for mKIAA0072

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220321
Description :	proteasome 26S non-ATPase subunit 5.
Clone Name :	mbr06207 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1536 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 40 bp

Genome contig ID gi66880554r_34684703
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTCCACCTAAAACAGCAGAATTTCCCAAGGCTCAC
Flanking genome sequence
(99996 - 99947)
----+----*----+----*----+----*----+----*----+----*
GATTCCATCCGTGCTCCACACCACAGGACGTCTGTCTTCCCAGGCACAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0072 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0072	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1496
Length: 497 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BJY1	1.4e-201	99.8	26S proteasome ...	Mus musculus
BAC37265	9.2e-201	99.6	unnamed protein...	Mus musculus
EDL93161	1.8e-196	96.6	proteasome (pro...	Rattus norvegicus
Q16401	2.7e-185	89.9	26S proteasome ...	Homo sapiens
BAF83740	3.7e-185	89.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	40 bp
Genome contig ID	gi66880554r_34684703
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCCACCTAAAACAGCAGAATTTCCCAAGGCTCAC
Flanking genome sequence (99996 - 99947)	----+--------+--------+--------+--------+----* GATTCCATCCGTGCTCCACACCACAGGACGTCTGTCTTCCCAGGCACAGC

Gene/Protein Characteristic Table for mKIAA0072

Features of the cloned DNA sequence

Features of the protein sequence