ROUGE

Gene/Protein Characteristic Table for mKIAA0031

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172875
Description :	116 kDa U5 small nuclear ribonucleoprotein component.
Clone Name :	mfj01557 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3278 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 323 bp

Genome contig ID gi65527427r_102559568
PolyA signal sequence
(TATAAA,-22)
+----*----+----*----+----*----+----
TTTAGCCACAGTTTATAAATGAACAGGACATTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTCTGCCTTGGTTTGCTGCTTTCGTTCACCCCCCACCCCGTCTGATCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0031 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0031	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 25..2955
Length: 976 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O08810	100.0	116 kDa U5 smal...	Mus musculus
BAE38301	99.9	unnamed protein...	Mus musculus
BAE32024	99.9	unnamed protein...	Mus musculus
CAM25113	99.9	elongation fact...	Mus musculus
XP_213492	99.8	similar to 116 ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000795 135 148 PR00315 Protein synthesis factor

IPR000795 180 188 PR00315 Protein synthesis factor

IPR000795 205 215 PR00315 Protein synthesis factor

IPR000795 221 232 PR00315 Protein synthesis factor

IPR000795 257 266 PR00315 Protein synthesis factor

HMMPfam IPR000795 131 446 PF00009 Protein synthesis factor

IPR004161 493 570 PF03144 Elongation factor Tu

IPR005517 709 828 PF03764 Elongation factor G

IPR000640 830 919 PF00679 Elongation factor G

HMMTigr IPR005225 131 305 TIGR00231 Small GTP-binding protein domain

ProfileScan NULL 7 55 PS50312 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	135	148	PR00315	Protein synthesis factor
IPR000795	180	188	PR00315	Protein synthesis factor
IPR000795	205	215	PR00315	Protein synthesis factor
IPR000795	221	232	PR00315	Protein synthesis factor
IPR000795	257	266	PR00315	Protein synthesis factor
HMMPfam	IPR000795	131	446	PF00009	Protein synthesis factor
IPR004161	493	570	PF03144	Elongation factor Tu
IPR005517	709	828	PF03764	Elongation factor G
IPR000640	830	919	PF00679	Elongation factor G
HMMTigr	IPR005225	131	305	TIGR00231	Small GTP-binding protein domain
ProfileScan	NULL	7	55	PS50312	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	323 bp
Genome contig ID	gi65527427r_102559568
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- TTTAGCCACAGTTTATAAATGAACAGGACATTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTCTGCCTTGGTTTGCTGCTTTCGTTCACCCCCCACCCCGTCTGATCC

Gene/Protein Characteristic Table for mKIAA0031

Features of the cloned DNA sequence

Features of the protein sequence