ROUGE |
Gene/Protein Characteristic Table for mKIAA0018 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129036 |
---|---|
24-dehydrocholesterol reductase. 3-beta-hydroxysterol delta-24 reductase. seladin-1. |
|
mfj00709 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4017 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2337 bp Genome contig ID gi65493515f_105420038 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ACCACTTGTGTAAAATAAAGTACAGCCTGGAAGCTFlanking genome sequence
(127982 - 128031) ----+----*----+----*----+----*----+----*----+----*
AGTCTTTTGTCATTTATTCAGAGGACCAGTGTAGAGTCGGACAAGGACGC
KIAA Alignment based on: KIAA0018 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..1680
Length: 559 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |