ROUGE

Gene/Protein Characteristic Table for mKIAA0011

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129033
Description :	General transcription factor 3C polypeptide 2.
Clone Name :	mpm05085 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4301 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1543 bp

Genome contig ID gi65498774r_29514945
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GCTTTTTGAACTAATAAAGAAGTGCCTTCCATTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAGGAGCTTGGCTTGTCCTGCAGAGCAACCCATCCATACAGCACATCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0011 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0011	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2758
Length: 918 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BL74	100.0	General transcr...	Mus musculus
BAC32629	99.9	unnamed protein...	Mus musculus
BAC38975	99.8	unnamed protein...	Mus musculus
AAH34369	99.7	Gtf3c2 protein ...	Mus musculus
BAE23772	99.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 465 519 PF00400 WD-40 repeat

IPR001680 552 591 PF00400 WD-40 repeat

IPR001680 611 649 PF00400 WD-40 repeat

IPR001680 834 872 PF00400 WD-40 repeat

HMMSmart IPR001680 463 519 SM00320 WD-40 repeat

IPR001680 541 591 SM00320 WD-40 repeat

IPR001680 609 649 SM00320 WD-40 repeat

IPR001680 832 872 SM00320 WD-40 repeat

ProfileScan IPR001680 616 651 PS50082 WD-40 repeat

IPR001680 616 658 PS50294 WD-40 repeat

ScanRegExp IPR001680 578 592 PS00678 WD-40 repeat

IPR001680 636 650 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	465	519	PF00400	WD-40 repeat
IPR001680	552	591	PF00400	WD-40 repeat
IPR001680	611	649	PF00400	WD-40 repeat
IPR001680	834	872	PF00400	WD-40 repeat
HMMSmart	IPR001680	463	519	SM00320	WD-40 repeat
IPR001680	541	591	SM00320	WD-40 repeat
IPR001680	609	649	SM00320	WD-40 repeat
IPR001680	832	872	SM00320	WD-40 repeat
ProfileScan	IPR001680	616	651	PS50082	WD-40 repeat
IPR001680	616	658	PS50294	WD-40 repeat
ScanRegExp	IPR001680	578	592	PS00678	WD-40 repeat
IPR001680	636	650	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1543 bp
Genome contig ID	gi65498774r_29514945
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GCTTTTTGAACTAATAAAGAAGTGCCTTCCATTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGGAGCTTGGCTTGTCCTGCAGAGCAACCCATCCATACAGCACATCTG

Gene/Protein Characteristic Table for mKIAA0011

Features of the cloned DNA sequence

Features of the protein sequence