| ROUGE | 
| Gene/Protein Characteristic Table for mFLJ00400 | 
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220211 | 
|---|---|
| epidermodysplasia verruciformis 2. transmembrane channel-like gene family 8. | |
| mlj03177 [Vector Info] | |
| Source : | Mouse adult splenocytes | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 2258 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | YES | 
Length of 3'UTR 1249 bp Genome contig ID gi65527427f_117504967 PolyA signal sequence 
(TATAAA,-21)
TCATGGATGCAATTTATAAATATATATATATATGTFlanking genome sequence 
(109237 - 109286)
ATATATTTGGAAATACTTGAATTTCTTGGACAAGAGTTGCTCTCAGAAAC
KIAA Alignment based on: FLJ00400 DNA sequence, AA sequence, Physical map 
| Features of the protein sequence | Description | |
Coding region: 2..1006, 1134..1940
Length: 603 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage   | |