ROUGE |
Gene/Protein Characteristic Table for mFLJ00400 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220211 |
---|---|
epidermodysplasia verruciformis 2. transmembrane channel-like gene family 8. |
|
mlj03177 [Vector Info] | |
Source : | Mouse adult splenocytes |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2258 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1249 bp Genome contig ID gi65527427f_117504967 PolyA signal sequence
(TATAAA,-21) +----*----+----*----+----*----+----
TCATGGATGCAATTTATAAATATATATATATATGTFlanking genome sequence
(109237 - 109286) ----+----*----+----*----+----*----+----*----+----*
ATATATTTGGAAATACTTGAATTTCTTGGACAAGAGTTGCTCTCAGAAAC
KIAA Alignment based on: FLJ00400 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1006, 1134..1940
Length: 603 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |