ROUGE

Gene/Protein Characteristic Table for mFLJ00380

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131183
Description :	Nuclear factor erythroid 2 related factor 1.
Clone Name :	mpg00559 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4573 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1746 bp

Genome contig ID gi65527427r_96538520
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
GTGAGCACATGACAAAATAAAATCAAATAAAATGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGATTCAGCTTAAGTGCACTTTCTCCCCCCTCTCCCTTCTGAATTCAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00380 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00380	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 524..2827
Length: 767 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21433	100.0	mFLJ00380 prote...	Mus musculus
AAH43063	100.0	Nuclear factor,...	Mus musculus
BAE32068	99.9	unnamed protein...	Mus musculus
Q61985	99.7	Nuclear factor ...	Mus musculus
BAE32418	99.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011616 647 711 PF00170 bZIP transcription factor

IPR011700 647 704 PF07716 Basic leucine zipper

HMMSmart IPR004827 647 711 SM00338 Basic-leucine zipper (bZIP) transcription factor

ProfileScan NULL 472 525 PS50324 NULL

IPR004827 651 712 PS50217 Basic-leucine zipper (bZIP) transcription factor

ScanRegExp IPR004827 654 669 PS00036 Basic-leucine zipper (bZIP) transcription factor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011616	647	711	PF00170	bZIP transcription factor
IPR011700	647	704	PF07716	Basic leucine zipper
HMMSmart	IPR004827	647	711	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	NULL	472	525	PS50324	NULL
IPR004827	651	712	PS50217	Basic-leucine zipper (bZIP) transcription factor
ScanRegExp	IPR004827	654	669	PS00036	Basic-leucine zipper (bZIP) transcription factor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1746 bp
Genome contig ID	gi65527427r_96538520
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GTGAGCACATGACAAAATAAAATCAAATAAAATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATTCAGCTTAAGTGCACTTTCTCCCCCCTCTCCCTTCTGAATTCAGA

Gene/Protein Characteristic Table for mFLJ00380

Features of the cloned DNA sequence

Features of the protein sequence