ROUGE

Gene/Protein Characteristic Table for mFLJ00367

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC026543
Description :	bridging integrator-3.
Clone Name :	mni15278 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 1460 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 672 bp

Genome contig ID gi65540054f_64334594
PolyA signal sequence
(AGTAAA,-16)
+----*----+----*----+----*----+----
TATTGGAATTTTATTTTCAAGTAAAGTTTTCCAGT
Flanking genome sequence
(119355 - 119404)
----+----*----+----*----+----*----+----*----+----*
AAAACAACAGTGTACTTTAACTGACACCAAGAGGGAGCTGTCACAGCTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00367 DNA sequence, Physical map

KIAA	Alignment based on:
FLJ00367	DNA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..785
Length: 261 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9JI08	2.9e-88	100.0	Bridging integr...	Mus musculus
BAE42110	8.6e-88	99.6	unnamed protein...	Mus musculus
Q68FW8	5e-86	98.0	Bridging integr...	Rattus norvegicus
EAW63655	1.9e-85	93.5	bridging integr...	Homo sapiens
XP_001490971	1.9e-84	95.7	similar to Brid...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004148 19 233 PF03114 BAR

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004148	19	233	PF03114	BAR

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	672 bp
Genome contig ID	gi65540054f_64334594
PolyA signal sequence (AGTAAA,-16)	+--------+--------+----*----+---- TATTGGAATTTTATTTTCAAGTAAAGTTTTCCAGT
Flanking genome sequence (119355 - 119404)	----+--------+--------+--------+--------+----* AAAACAACAGTGTACTTTAACTGACACCAAGAGGGAGCTGTCACAGCTTT

Gene/Protein Characteristic Table for mFLJ00367

Features of the cloned DNA sequence

Features of the protein sequence