ROUGE

Gene/Protein Characteristic Table for mFLJ00319

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220245
Description :	galactosamine (N-acetyl)-6-sulfate sulfatase. N-acetylgalactosamine-6-sulfate sulfatase.
Clone Name :	mib36033 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2487 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 873 bp

Genome contig ID gi65515060r_121859976
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
TGGGATTAAAGGCGTGCGCCATCATGAGACCACCT
Flanking genome sequence
(99850 - 99801)
----+----*----+----*----+----*----+----*----+----*
ATCCTGGTCTTTTGTTTGTTTGTTTGTTTTTATTTTTTTCAAGGCAGGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00319 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00319	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1614
Length: 537 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD90170	100.0	mFLJ00319 prote...	Mus musculus
Q571E4	100.0	N-acetylgalacto...	Mus musculus
AAF63155	99.8	N-acetylgalacto...	Mus musculus
AAH04002	99.0	Galactosamine (...	Mus musculus
Q32KJ6	95.2	N-acetylgalacto...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK004540	6.7e-56	36.1	mKIAA4172
AK173082	2.2e-31	36.9	mKIAA1001
AK129278	5e-05	25.4	mKIAA1077

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000917 44 468 PF00884 Sulfatase

ScanRegExp IPR000917 91 103 PS00523 Sulfatase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000917	44	468	PF00884	Sulfatase
ScanRegExp	IPR000917	91	103	PS00523	Sulfatase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	873 bp
Genome contig ID	gi65515060r_121859976
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- TGGGATTAAAGGCGTGCGCCATCATGAGACCACCT
Flanking genome sequence (99850 - 99801)	----+--------+--------+--------+--------+----* ATCCTGGTCTTTTGTTTGTTTGTTTGTTTTTATTTTTTTCAAGGCAGGGT

Gene/Protein Characteristic Table for mFLJ00319

Features of the cloned DNA sequence

Features of the protein sequence