| ROUGE |
Gene/Protein Characteristic Table for mFLJ00285 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220312 |
|---|---|
| polycystin-1. | |
| mfj26301 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4830 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 0 bp Genome contig ID gi65550231f_22268688 PolyA signal sequence
(None)
GGGTGGCCTGAGTATCAGAACCAGTGAGCAGCAACFlanking genome sequence
(109667 - 109716)
GATAGCATCTTTGTGGCAGCTGGCTCCACTCTACCCTTCTGGGGTCAGCT
KIAA Alignment based on: FLJ00285 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2316..4829
Length: 838 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage 
| |
