ROUGE |
Gene/Protein Characteristic Table for mFLJ00279 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131171 |
---|---|
Myosin heavy chain, smooth muscle isoform. | |
mpg01084 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5254 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1244 bp Genome contig ID gi65543215r_77712547 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TCCACTGAGCGTCACAATAAAGAGTACCATGTCCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTCTTTGGTGTCTGGGTGTTTGGCTACAGCGGGAGAAGGCCGGGAAGGG
KIAA Alignment based on: FLJ00279 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..4010
Length: 1335 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |