ROUGE |
Gene/Protein Characteristic Table for mFLJ00240 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131164 |
---|---|
mbg05043 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4647 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 935 bp Genome contig ID gi65540054f_49908623 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
CCCACTTGTATAGAATTAAAAAAAAAATCACTGTCFlanking genome sequence
(117175 - 117224) ----+----*----+----*----+----*----+----*----+----*
TGCCTCTGGTCTCTGCTGTGCAAGCTTTGCATTTTTCCCACACACACACC
KIAA Alignment based on: FLJ00240 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 524..2293, 3789..4328
Length: 769 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |