| ROUGE |
Gene/Protein Characteristic Table for mFLJ00205 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK131155 |
|---|---|
| UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10. UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9. |
|
| mfj07125 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4672 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2765 bp Genome contig ID gi65527427f_57271185 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ACTGTGGTTGTTCAATAAACCTCCAGACTTTCTCTFlanking genome sequence
(241945 - 241994) ----+----*----+----*----+----*----+----*----+----*
AAAGCAGTGTCTGGCATGTCCCTTGTCACCTGCCTTTCTGTCCATGTCCT
KIAA Alignment based on: FLJ00205 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1907
Length: 634 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |