ROUGE |
Gene/Protein Characteristic Table for mFLJ00157 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131141 |
---|---|
SEC6-like 1. | |
mfj31007 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4582 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2269 bp Genome contig ID gi65535943r_70131957 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AATGATCTAAAATTAAAATAAAAAATGTGTTGCGGFlanking genome sequence
(99972 - 99923) ----+----*----+----*----+----*----+----*----+----*
GACCTCTAGAGCTCTGCCTTGTACTGTCCCTCCCCTGACCTACGGAGAAC
KIAA Alignment based on: FLJ00157 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..2313
Length: 770 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |