ROUGE |
Gene/Protein Characteristic Table for mFLJ00069 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK077947 |
---|---|
CTF18, chromosome transmission fidelity factor 18 homolog. Chl12 homolog. |
|
mph01671 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3016 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 107 bp Genome contig ID gi65550231r_23425042 PolyA signal sequence
(TATAAA,-28) +----*----+----*----+----*----+----
GTCTATTTATAAAGTCACACCTTACAGAGAGTGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GGTCAGGCTCATAGGATGGTGCACTTGGCCTTCTCTACCCAAGGGTTGTT
KIAA Alignment based on: FLJ00069 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2909
Length: 968 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |