HUGE

Gene/Protein Characteristic Table for KIAA2038

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00971
Accession No. :	AB124552
Description :	Protein FAM59B (Fragment).
HUGO Gene Name :	family with sequence similarity 59, member B (FAM59B)
Clone Name :	pj01991 [Vector Info]
Flexi ORF Clone :	pF1KSDA2038
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4142 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1387 bp

Genome contig ID gi89161199f_26149527
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCTCAAGGACTAATGAAATAAATGCTAGACTGCTG
Flanking genome sequence
(116492 - 116541)
----+----*----+----*----+----*----+----*----+----*
AAGATGAGTACAAGTGGCATTCTGGGTGCCAGCTGCTTTCTTCTTTTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 26249464 26266017 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q75VX8	0	100.0	Protein FAM59B.	Homo sapiens
BAG10206	0	100.0	FAM59B protein ...	synthetic construct
XP_001086318	0	96.9	hypothetical pr...	Macaca mulatta
XP_343128	1.7e-167	87.3	hypothetical pr...	Rattus norvegicus
Q6PAJ3	5e-137	87.0	Protein FAM59B.	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 850 914 PF00536 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	850	914	PF00536	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1387 bp
Genome contig ID	gi89161199f_26149527
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCTCAAGGACTAATGAAATAAATGCTAGACTGCTG
Flanking genome sequence (116492 - 116541)	----+--------+--------+--------+--------+----* AAGATGAGTACAAGTGGCATTCTGGGTGCCAGCTGCTTTCTTCTTTTGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	26249464	26266017	6	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA2038

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information