HUGE |
Gene/Protein Characteristic Table for KIAA2038 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00971 |
---|---|
Accession No. : | AB124552 |
Description : | Protein FAM59B (Fragment). |
HUGO Gene Name : | family with sequence similarity 59, member B (FAM59B) |
Clone Name : | pj01991 [Vector Info] |
Flexi ORF Clone : | pF1KSDA2038 |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4142 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1387 bp Genome contig ID gi89161199f_26149527 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CCTCAAGGACTAATGAAATAAATGCTAGACTGCTGFlanking genome sequence
(116492 - 116541) ----+----*----+----*----+----*----+----*----+----*
AAGATGAGTACAAGTGGCATTCTGGGTGCCAGCTGCTTTCTTCTTTTGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 26249464 26266017 6 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 917 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |