HUGE |
Gene/Protein Characteristic Table for KIAA2037 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05838 |
---|---|
Accession No. : | AB111889 |
Description : | lin-54 homolog. |
HUGO Gene Name : | |
Clone Name : | pj01545 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4506 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2553 bp Genome contig ID gi89161207r_83965725 PolyA signal sequence
(CATAAA,-19) +----*----+----*----+----*----+----
GCTCAGTTATTACTAACATAAATTGCTTTGAAATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGAATATGTCTTCTCTTTTTTTCCCCACTGTTTCTTTTAAGAGCAGAAAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 r 84065725 84150998 13 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 494 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 4 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |